About   Help   FAQ
D4Mit155 Primer Detail
Primers
  • Name
    D4Mit155
  • Primer 1 Sequence
    GCCTTTCCCTTCAAGTACACC
  • Primer 2 Sequence
    CAGATTTTAACTGTATGGATGTGTG
  • ID
    MGI:703832
  • Product Size
    200
  • Other IDs
    D4Mit155 (BROAD)
  • Note
    MIT assay: MT1274
    Additional information: MIT STS Marker Data Files
Genes
D4Mit155 DNA segment, Chr 4, Massachusetts Institute of Technology 155
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit155 a 179bp CAST/EiJ
b 189bp A/J, BALB/cJ, C3H/HeJ
c 193bp AKR/J
d 195bp LP/J, NOD/MrkTac, NON/ShiLt
e 201bp B6.Cg-Lepob/+, DBA/2J, SPRET/EiJ
f 205bp C57BL/6J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit155 c 113bp CBA/CaOlaHsd
s 131bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/12/2024
MGI 6.24 		The Jackson Laboratory