D6Mit339 Primer Detail MGI Mouse MGI:703848

D6Mit339 Primer Detail

Name

D6Mit339
Primer 1 Sequence

ATATCGATTGGCTTCTAAATGTCA
Primer 2 Sequence

GCAGGTTGTCCTCTCACCTC
ID

MGI:703848
Product Size

118
Other IDs

D6Mit339 (BROAD)
Note

MIT assay: MTH1167
Additional information: MIT STS Marker Data Files

D6Mit339

DNA Segment, Chr 6, Massachusetts Institute of Technology 339

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit339	a	94bp	CAST/EiJ
	b	100bp	BALB/cJ, LP/J
	c	110bp	A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
	d	114bp	SPRET/EiJ
	e	116bp	NON/ShiLt
	f	118bp	B6.Cg-Lep^ob/+, C57BL/6J

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit339	b	lower	C57BL/6J
	D6Mit339	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24