About   Help   FAQ
D6Mit183 Primer Detail
Primers
  • Name
    D6Mit183
  • Primer 1 Sequence
    TTCTCAATGAACACTAGAACATTCG
  • Primer 2 Sequence
    AAAACACAGGTAGAAAACATACATACA
  • ID
    MGI:703861
  • Product Size
    104
  • Other IDs
    D6Mit183 (BROAD)
  • Note
    MIT assay: MT2304
    Additional information: MIT STS Marker Data Files
Genes
D6Mit183 DNA segment, Chr 6, Massachusetts Institute of Technology 183
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit183 a 98bp C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
b 100bp AKR/J
c 104bp C57BL/6J
d 106bp B6.Cg-Lepob/+
e 108bp CAST/EiJ
f 162bp A/J, BALB/cJ
g 166bp NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D6Mit183 b 102bp C57BL/6JOlaHsd, C57BL/10
c 156bp A/JOlaHsd, BALB/cJ
d 94bp 129P3/J, AKR/OlaHsd, C3H/HeJ, DBA/2J
j 190bp JF1
l 96bp SJL/J
p 170bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory