DXMit10 Primer Detail MGI Mouse MGI:703865

DXMit10 Primer Detail

Name

DXMit10
Primer 1 Sequence

GAATTACAGGCATGCGTCCT
Primer 2 Sequence

TGTTTGACTGAGAGGATGCG
ID

MGI:703865
Product Size

239
Other IDs

DXMit10 (BROAD)
Note

MIT assay: A1124
Additional information: MIT STS Marker Data Files

DXMit10

DNA segment, Chr X, Massachusetts Institute of Technology 10

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit10	a	236bp	A/J, BALB/cJ, LP/J, NOD/MrkTac
	b	238bp	AKR/J, C3H/HeJ, DBA/2J
	c	240bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	d	272bp	CAST/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit10	c	smaller	CBA/Kw
	DXMit10	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24