About   Help   FAQ
DXMit10 Primer Detail
Primers
  • Name
    DXMit10
  • Primer 1 Sequence
    GAATTACAGGCATGCGTCCT
  • Primer 2 Sequence
    TGTTTGACTGAGAGGATGCG
  • ID
    MGI:703865
  • Product Size
    239
  • Other IDs
    DXMit10 (BROAD)
  • Note
    MIT assay: A1124
    Additional information: MIT STS Marker Data Files
Genes
DXMit10 DNA segment, Chr X, Massachusetts Institute of Technology 10
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit10 a 236bp A/J, BALB/cJ, LP/J, NOD/MrkTac
b 238bp AKR/J, C3H/HeJ, DBA/2J
c 240bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
d 272bp CAST/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
DXMit10 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory