DXMit17 Primer Detail MGI Mouse MGI:703868

DXMit17 Primer Detail

Name

DXMit17
Primer 1 Sequence

CCTGTTTGGGCACCTAGATT
Primer 2 Sequence

TAATAACCCATGTTTTCTGTGGG
ID

MGI:703868
Product Size

200
Other IDs

DXMit17 (BROAD)
Note

MIT assay: B350
Additional information: MIT STS Marker Data Files

DXMit17

DNA segment, Chr X, Massachusetts Institute of Technology 17

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit17	m	258bp	MOLF/EiJ
Not Specified	DXMit17	s	222bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit17	a	194bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	210bp	SPRET/EiJ
	c	228bp	CAST/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24