DXMit197 Primer Detail MGI Mouse MGI:703878

DXMit197 Primer Detail

Name

DXMit197
Primer 1 Sequence

TGTTCTATATTGCTTTGTTAGGTTTTG
Primer 2 Sequence

GCAAAAAAGAAACCAACCCA
ID

MGI:703878
Product Size

120
Other IDs

DXMit197 (BROAD)
Note

MIT assay: MTH1899
Additional information: MIT STS Marker Data Files

DXMit197

DNA Segment, Chr X, Massachusetts Institute of Technology 197

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit197	a	122bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
	b	124bp	SPRET/EiJ
	c	138bp	NON/ShiLt
	d	150bp	A/J, BALB/cJ, NOD/MrkTac
	e	160bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit197	a	150bp	A.CA/W, BALB/cW, BN/aW
	DXMit197	b	122bp	129/SvW, AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24