D16Mit12 Primer Detail MGI Mouse MGI:703891

D16Mit12 Primer Detail

Name

D16Mit12
Primer 1 Sequence

GAACTCAGTAAGCTCTCTATGCCC
Primer 2 Sequence

GGAGGACTAGCAGGCTAGAGC
ID

MGI:703891
Product Size

192
Other IDs

D16Mit12 (BROAD)
Note

MIT assay: A888
Additional information: MIT STS Marker Data Files

D16Mit12

DNA segment, Chr 16, Massachusetts Institute of Technology 12

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit12	c	156bp	C3HeB/FeJLe
	D16Mit12	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit12	a	156bp	C3H/HeJ, DBA/2J, LP/J
	b	174bp	CAST/EiJ
	c	178bp	SPRET/EiJ
	d	180bp	A/J, AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
	e	192bp	B6.Cg-Lep^ob/+, C57BL/6J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit12	c	larger	CBA/Kw
	D16Mit12	e	smallerq	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24