About   Help   FAQ
D16Mit32 Primer Detail
Primers
  • Name
    D16Mit32
  • Primer 1 Sequence
    CTTCTGCCAACACTGCTTACA
  • Primer 2 Sequence
    AGAAAGACTGCTGAGATCCAGG
  • ID
    MGI:703895
  • Product Size
    110
  • Other IDs
    D16Mit32 (BROAD)
  • Note
    MIT assay: MPC1416
    Additional information: MIT STS Marker Data Files
Genes
D16Mit32 DNA segment, Chr 16, Massachusetts Institute of Technology 32
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit32 m 152bp MOLF/EiJ
s 120bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit32 a 110bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
b 116bp SPRET/EiJ
c 118bp NON/ShiLt
d 120bp A/J
e 140bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D16Mit32 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D16Mit32 c 109bp CBA/CaOlaHsd
s 117bp SWR/OlaHsd
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
10/09/2024
MGI 6.24 		The Jackson Laboratory