D16Mit15 Primer Detail MGI Mouse MGI:703898

D16Mit15 Primer Detail

Name

D16Mit15
Primer 1 Sequence

TTCCATTCATATACCTGCAAGTG
Primer 2 Sequence

CTGAAGCTGTTAAATGCTGCC
ID

MGI:703898
Product Size

139
Other IDs

D16Mit15 (BROAD)
Note

MIT assay: A738
Additional information: MIT STS Marker Data Files

D16Mit15

DNA segment, Chr 16, Massachusetts Institute of Technology 15

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit15	c	120bp	C3HeB/FeJLe
	D16Mit15	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit15	a	118bp	CAST/EiJ
	b	120bp	C3H/HeJ
	c	142bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	144bp	A/J
	e	146bp	AKR/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24