DXMit141 Primer Detail MGI Mouse MGI:703921

DXMit141 Primer Detail

Name

DXMit141
Primer 1 Sequence

CTCAGAGACTTGAGACGTAATTTCC
Primer 2 Sequence

ATTCATTCTCCAACAAAGGGG
ID

MGI:703921
Product Size

144
Other IDs

DXMit141 (BROAD)
Note

MIT assay: MT2779
Additional information: MIT STS Marker Data Files

DXMit141

DNA segment, Chr X, Massachusetts Institute of Technology 141

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit141	a	150bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	154bp	129X1/SvJ
		c	134bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit141	a	122bp	CAST/EiJ
	b	130bp	LP/J
	c	132bp	A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
	d	134bp	BALB/cJ
	e	136bp	B6.Cg-Lep^ob/+, C57BL/6J, SPRET/EiJ
	f	138bp	NON/ShiLt

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
DXMit141	c	larger	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit141	c	122bp	CBA/CaOlaHsd
	DXMit141	s	112bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24