D7Mit43 Primer Detail MGI Mouse MGI:703937

D7Mit43 Primer Detail

Name

D7Mit43
Primer 1 Sequence

GATATAGGGTGTCTTCCTCAATCA
Primer 2 Sequence

AGACCTCTCTCACCAGAAGCC
ID

MGI:703937
Product Size

211
Other IDs

D7Mit43 (BROAD)
Note

MIT assay: A671
Additional information: MIT STS Marker Data Files

D7Mit43

DNA segment, Chr 7, Massachusetts Institute of Technology 43

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit43	m	191bp	MOLF/EiJ
Not Specified	D7Mit43	s	80bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit43	a	214bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	240bp	SPRET/EiJ
	c	242bp	CAST/EiJ

J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit43	l	0.210kb	SB/LeJ
	D7Mit43	s	0.212kb	M. spretus

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24