About   Help   FAQ
D7Mit43 Primer Detail
Primers
  • Name
    D7Mit43
  • Primer 1 Sequence
    GATATAGGGTGTCTTCCTCAATCA
  • Primer 2 Sequence
    AGACCTCTCTCACCAGAAGCC
  • ID
    MGI:703937
  • Product Size
    211
  • Other IDs
    D7Mit43 (BROAD)
  • Note
    MIT assay: A671
    Additional information: MIT STS Marker Data Files
Genes
D7Mit43 DNA segment, Chr 7, Massachusetts Institute of Technology 43
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit43 m 191bp MOLF/EiJ
s 80bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit43 a 214bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 240bp SPRET/EiJ
c 242bp CAST/EiJ
J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43
Endonuclease Gene Allele Fragments Strains
D7Mit43 l 0.210kb SB/LeJ
s 0.212kb M. spretus
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory