D7Mit46 Primer Detail MGI Mouse MGI:703940

D7Mit46 Primer Detail

Name

D7Mit46
Primer 1 Sequence

AATAGAACTTAATTGGCACAAGCC
Primer 2 Sequence

CAATTATGTGGGTGTGCATACC
ID

MGI:703940
Product Size

182
Other IDs

D7Mit46 (BROAD)
Note

MIT assay: D551
Additional information: MIT STS Marker Data Files

D7Mit46

DNA segment, Chr 7, Massachusetts Institute of Technology 46

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit46	a	182bp	A/J, B6.Cg-Lep^ob/+
	b	184bp	AKR/J, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	c	190bp	CAST/EiJ
	d	192bp	SPRET/EiJ
	e	196bp	BALB/cJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D7Mit46	c	195bp	BALB/cJ
	d	181bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J, PWB, SJL/J
	j	187bp	JF1

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24