About   Help   FAQ
D5Mit297 Primer Detail
Primers
  • Name
    D5Mit297
  • Primer 1 Sequence
    TCTGACCTCCACACATGCAC
  • Primer 2 Sequence
    CTAAGGGACTCTTTGCTCATCC
  • ID
    MGI:703953
  • Product Size
    125
  • Other IDs
    D5Mit297 (BROAD)
  • Note
    MIT assay: MT4785
    Additional information: MIT STS Marker Data Files
Genes
D5Mit297 DNA segment, Chr 5, Massachusetts Institute of Technology 297
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit297 a 118bp SPRET/EiJ
b 122bp CAST/EiJ
c 126bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac
d 134bp DBA/2J, NON/ShiLt
e 144bp BALB/cJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D5Mit297 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory