D1Mit296 Primer Detail MGI Mouse MGI:703960

D1Mit296 Primer Detail

Name

D1Mit296
Primer 1 Sequence

CAAGTGGACAGAAATAAACATAGAGC
Primer 2 Sequence

CAACTGATGCATTTTTCAAACTG
ID

MGI:703960
Product Size

145
Other IDs

D1Mit296 (BROAD)
Note

MIT assay: MT3304
Additional information: MIT STS Marker Data Files

D1Mit296

DNA segment, Chr 1, Massachusetts Institute of Technology 296

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit296	a	140bp	AKR/J, LP/J
	b	142bp	A/J, BALB/cJ, DBA/2J
	c	146bp	NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	d	150bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	154bp	C3H/HeJ, CAST/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit296	c	upper	CBA/Kw
	D1Mit296	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24