About   Help   FAQ
D1Mit293 Primer Detail
Primers
  • Name
    D1Mit293
  • Primer 1 Sequence
    AGACAGAGAGCAATAGATGAAGACC
  • Primer 2 Sequence
    ACTGACCCGCTCTTCTCTACC
  • ID
    MGI:703965
  • Product Size
    149
  • Other IDs
    D1Mit293 (BROAD)
  • Note
    MIT assay: MT2613
    Additional information: MIT STS Marker Data Files
Genes
D1Mit293 DNA segment, Chr 1, Massachusetts Institute of Technology 293
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit293 a 116bp AKR/J, BALB/cJ
b 128bp SPRET/EiJ
c 148bp CAST/EiJ
d 150bp LP/J, NOD/MrkTac
e 154bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
f 156bp DBA/2J, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit293 c 151bp CBA/CaOlaHsd
s 155bp SWR/OlaHsd
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D1Mit293 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory