D4Mit254 Primer Detail MGI Mouse MGI:703971

D4Mit254 Primer Detail

Name

D4Mit254
Primer 1 Sequence

AATACAATTATCATTTGCATTGTGG
Primer 2 Sequence

TCGTGGTGGACCTTATCTCC
ID

MGI:703971
Product Size

135
Other IDs

D4Mit254 (BROAD)
Note

MIT assay: MT2963
Additional information: MIT STS Marker Data Files

D4Mit254

DNA segment, Chr 4, Massachusetts Institute of Technology 254

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit254	a	117bp	BALB/cJ
	b	135bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	137bp	A/J, AKR/J, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ

J:68682 Li X, et al., Mamm Genome. 2001 Jan;12(1):13-6

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit254	a	bigger	C57BL/6ByJ
	D4Mit254	b	smaller	129P3/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:68682 Li X, et al., High-resolution genetic mapping of the saccharin preference locus (Sac) and the putative sweet taste receptor (T1R1) gene (Gpr70) to mouse distal Chromosome 4. Mamm Genome. 2001 Jan;12(1):13-6

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24