About   Help   FAQ
D4Mit251 Primer Detail
Primers
  • Name
    D4Mit251
  • Primer 1 Sequence
    AAAAATCGTTCTTTGACTTCTACATG
  • Primer 2 Sequence
    TTTAAAAGGGTTTCTTTATCCTGTG
  • ID
    MGI:703974
  • Product Size
    114
  • Other IDs
    D4Mit251 (BROAD)
  • Note
    MIT assay: MT4191
    Additional information: MIT STS Marker Data Files
Genes
D4Mit251 DNA segment, Chr 4, Massachusetts Institute of Technology 251
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit251 a 96bp CAST/EiJ
b 106bp A/J, AKR/J
c 116bp B6.Cg-Lepob/+, C57BL/6J, LP/J
d 120bp SPRET/EiJ
e 128bp C3H/HeJ
f 134bp BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D4Mit251 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit251 c 165bp CBA/CaOlaHsd
s 123bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory