D19Mit95 Primer Detail MGI Mouse MGI:703990

D19Mit95 Primer Detail

Name

D19Mit95
Primer 1 Sequence

CCAGACAAAGAGTTAAGTATTGAAAA
Primer 2 Sequence

TTGCCAGCATCTGCTAACAC
ID

MGI:703990
Product Size

99
Other IDs

D19Mit95 (BROAD)
Note

MIT assay: MJ4494
Additional information: MIT STS Marker Data Files

D19Mit95

DNA segment, Chr 19, Massachusetts Institute of Technology 95

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit95	a	98bp	A/J
	b	102bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac
	c	110bp	AKR/J, C3H/HeJ, DBA/2J, NON/ShiLt, SPRET/EiJ
	d	118bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D19Mit95	a	110bp	AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
	b	102bp	129/SvW, BALB/cW, C57BL/6W, C57BL/10W
	c	98bp	A.CA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24