DXMit73 Primer Detail MGI Mouse MGI:704013

DXMit73 Primer Detail

Name

DXMit73
Primer 1 Sequence

GTGCACATTTGTGTGTGTATGC
Primer 2 Sequence

ACATGAAAGTTAGAAAGAGACCCG
ID

MGI:704013
Product Size

113
Note

MIT assay: MT840

DXMit73

DNA segment, Chr X, Massachusetts Institute of Technology 73

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit73	a	115bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	121bp	129X1/SvJ
		c	103bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit73	a	109bp	SPRET/EiJ
	b	113bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	123bp	CAST/EiJ
	d	125bp	A/J, BALB/cJ, C3H/HeJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24