About   Help   FAQ
D1Mit87 Primer Detail
Primers
  • Name
    D1Mit87
  • Primer 1 Sequence
    CACATGCAGTGGCACATATT
  • Primer 2 Sequence
    TTTTACCATGGGGTTATTCAGG
  • ID
    MGI:704027
  • Product Size
    205
  • Other IDs
    D1Mit87 (BROAD)
  • Note
    MIT assay: MPC148
    Additional information: MIT STS Marker Data Files
Genes
D1Mit87 DNA segment, Chr 1, Massachusetts Institute of Technology 87
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit87 a 198bp AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
b 204bp B6.Cg-Lepob/+, C57BL/6J, LP/J
c 206bp A/J, BALB/cJ
d 210bp SPRET/EiJ
e 218bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit87 c 206bp CBA/CaOlaHsd
s 204bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory