D1Mit80 Primer Detail MGI Mouse MGI:704032

D1Mit80 Primer Detail

Name

D1Mit80
Primer 1 Sequence

CATAGACAAGTCTCTGAACCATGG
Primer 2 Sequence

ACTACATAGCCAATAGCCCTGG
ID

MGI:704032
Product Size

140
Note

MIT assay: MPC971

D1Mit80

DNA segment, Chr 1, Massachusetts Institute of Technology 80

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit80	b	larger	C57BL/6J
	D1Mit80	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit80	a	120bp	CAST/EiJ
	b	134bp	A/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
	c	144bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit80	a	144bp	AKR/W, BALB/cW, C57BL/6W, C57BL/10W, CBA/W
	D1Mit80	b	134bp	129/SvW, BN/aW, C3H/W, DBA/2W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13