D12Mit221 Primer Detail MGI Mouse MGI:704066

D12Mit221 Primer Detail

Name

D12Mit221
Primer 1 Sequence

CTCATCAGAAATCTCTGGATTCG
Primer 2 Sequence

CCAAAGAAAAATAAGGTTACGTACG
ID

MGI:704066
Product Size

108
Other IDs

D12Mit221 (BROAD)
Note

MIT assay: MTH341
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 221

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit221	a	90bp	A/J, BALB/cJ, C3H/HeJ
	b	106bp	AKR/J, LP/J, NOD/MrkTac
	c	108bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	d	112bp	DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D12Mit221	a	100bp	129P3/J, AKR/OlaHsd, SJL/J
	b	102bp	C57BL/6JOlaHsd, C57BL/10
	c	82bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, JF1
	d	106bp	DBA/2J, PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24