D12Mit201 Primer Detail MGI Mouse MGI:704074

D12Mit201 Primer Detail

Name

D12Mit201
Primer 1 Sequence

CCACTGGATGGCAACAGAC
Primer 2 Sequence

TATGTGTTTCAAAACCACACTCG
ID

MGI:704074
Product Size

215
Other IDs

D12Mit201 (BROAD)
Note

MIT assay: MT3814
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 201

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit201	a	214bp	129X1/Sv
Not Specified	D12Mit201	f	202bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit201	a	194bp	SPRET/EiJ
	b	196bp	CAST/EiJ
	c	202bp	A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
	d	206bp	NOD/MrkTac
	e	212bp	AKR/J, B6.Cg-Lep^ob/+
	f	214bp	C57BL/6J, DBA/2J
	g	220bp	LP/J

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D12Mit201	c	not given	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D12Mit201	c	202bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	216bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	g	226bp	129P3/J
	j	232bp	JF1
	l	208bp	SJL/J
	p	236bp	PWB

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit201	c	201bp	CBA/CaOlaHsd
	D12Mit201	s	198bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24