D13Mit51 Primer Detail MGI Mouse MGI:704077

D13Mit51 Primer Detail

Name

D13Mit51
Primer 1 Sequence

TCCTGCAAAAGTGGAGCC
Primer 2 Sequence

TGGAAACAAGCTCTTGGAGG
ID

MGI:704077
Product Size

146
Other IDs

D13Mit51 (BROAD)
Note

MIT assay: B580
Additional information: MIT STS Marker Data Files

D13Mit51

DNA segment, Chr 13, Massachusetts Institute of Technology 51

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit51	m	148bp	MOLF/EiJ
Not Specified	D13Mit51	s	154bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit51	a	100bp	CAST/EiJ
	b	140bp	BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
	c	146bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	d	148bp	A/J, AKR/J, NOD/MrkTac

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit51	l	larger	LG/J
	D13Mit51	s	smaller	SM/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24