About   Help   FAQ
D13Mit51 Primer Detail
Primers
  • Name
    D13Mit51
  • Primer 1 Sequence
    TCCTGCAAAAGTGGAGCC
  • Primer 2 Sequence
    TGGAAACAAGCTCTTGGAGG
  • ID
    MGI:704077
  • Product Size
    146
  • Other IDs
    D13Mit51 (BROAD)
  • Note
    MIT assay: B580
    Additional information: MIT STS Marker Data Files
Genes
D13Mit51 DNA segment, Chr 13, Massachusetts Institute of Technology 51
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit51 m 148bp MOLF/EiJ
s 154bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit51 a 100bp CAST/EiJ
b 140bp BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
c 146bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
d 148bp A/J, AKR/J, NOD/MrkTac
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D13Mit51 l larger LG/J
s smaller SM/J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory