D13Mit53 Primer Detail MGI Mouse MGI:704079

D13Mit53 Primer Detail

Name

D13Mit53
Primer 1 Sequence

TTGCATGCCAACTTTCCATA
Primer 2 Sequence

AAACCCAACTAAGACATAAGGCA
ID

MGI:704079
Product Size

147
Other IDs

D13Mit53 (BROAD)
Note

MIT assay: B598
Additional information: MIT STS Marker Data Files

D13Mit53

DNA segment, Chr 13, Massachusetts Institute of Technology 53

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit53	a	140bp	A/J, CAST/EiJ
	b	144bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J
	c	152bp	AKR/J, BALB/cJ, C3H/HeJ, NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D13Mit53	c	156bp	AKR/OlaHsd, BALB/cJ, C3H/HeJ
	d	148bp	129P3/J, C57BL/6JOlaHsd, DBA/2J, SJL/J
	p	140bp	PWB
	r	144bp	C57BL/10
	w	142bp	A/JOlaHsd, JF1

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit53	c	larger	CBA/Kw
	D13Mit53	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13