D1Mit75 Primer Detail MGI Mouse MGI:704088

D1Mit75 Primer Detail

Name

D1Mit75
Primer 1 Sequence

AAATCACCATGGATTTGGTTG
Primer 2 Sequence

CCTGTGCCAACAAATTACCC
ID

MGI:704088
Product Size

192
Other IDs

D1Mit75 (BROAD)
Note

MIT assay: MPC1615
Additional information: MIT STS Marker Data Files

D1Mit75a	DNA segment, Chr 1, Massachusetts Institute of Technology 75a
D1Mit75b	DNA segment, Chr 1, Massachusetts Institute of Technology 75b

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit75a	a	164bp	BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
	b	172bp	CAST/EiJ
	c	176bp	B6.Cg-Lep^ob/+
	d	180bp	AKR/J, DBA/2J
	e	194bp	A/J, C3H/HeJ, C57BL/6J, SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit75a	a	194bp	A.CA/W, AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	D1Mit75a	b	164bp	129/SvW, BALB/cW, BN/aW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24