About   Help   FAQ
D13Mit204 Primer Detail
Primers
  • Name
    D13Mit204
  • Primer 1 Sequence
    CCAGTTTATCTAGTGAAATCTAGGCC
  • Primer 2 Sequence
    GTGTTGAAAACAAAATCCTTTCTC
  • ID
    MGI:704099
  • Product Size
    272
  • Other IDs
    D13Mit204 (BROAD)
  • Note
    MIT assay: MT2873
    Additional information: MIT STS Marker Data Files
Genes
D13Mit204 DNA segment, Chr 13, Massachusetts Institute of Technology 204
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit204 a 264bp SPRET/EiJ
b 268bp A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 272bp B6.Cg-Lepob/+
d 276bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D13Mit204 c 265bp CBA/CaOlaHsd
s 269bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory