D13Mit202 Primer Detail MGI Mouse MGI:704105

D13Mit202 Primer Detail

Name

D13Mit202
Primer 1 Sequence

TGACTCAAAAAGGTAGATAGATGGC
Primer 2 Sequence

GATGCTATGTGTACATGCTTGTAGG
ID

MGI:704105
Product Size

141
Other IDs

D13Mit202 (BROAD)
Note

MIT assay: MT2365
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 202

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit202	a	139bp	129X1/Sv
Not Specified	D13Mit202	f	121, 133, 139bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit202	a	121bp	AKR/J
	b	133bp	A/J, NOD/MrkTac
	c	137bp	LP/J, NON/ShiLt
	d	139bp	C3H/HeJ, DBA/2J
	e	141bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	145bp	BALB/cJ
	g	147bp	CAST/EiJ
	h	166bp	SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D13Mit202	c	not given	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D13Mit202	a	114bp	AKR/OlaHsd
	b	136bp	129P3/J, C57BL/6JOlaHsd, C57BL/10
	c	140bp	BALB/cJ, JF1
	d	134bp	C3H/HeJ, DBA/2J, SJL/J
	p	142bp	PWB
	w	128bp	A/JOlaHsd

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit202	c	138bp	CBA/CaOlaHsd
	D13Mit202	s	148bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24