D11Mit168 Primer Detail MGI Mouse MGI:704126

D11Mit168 Primer Detail

Name

D11Mit168
Primer 1 Sequence

CAGGGATTTGACTTTTAACCTCC
Primer 2 Sequence

GAAATGGCTCCTACAACCTCC
ID

MGI:704126
Product Size

147
Other IDs

D11Mit168 (BROAD)
Note

MIT assay: MT1250
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 168

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit168	a	123bp	BALB/cJ, NOD/MrkTac
	b	133bp	AKR/J, CAST/EiJ, NON/ShiLt
	c	143bp	SPRET/EiJ
	d	147bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	e	153bp	A/J, C3H/HeJ

J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit168	c	upper	CBA/Kw
	D11Mit168	k	lower	KE

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit168	b	lower	C57BL/6J
	D11Mit168	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24