D11Mit163 Primer Detail MGI Mouse MGI:704133

D11Mit163 Primer Detail

Name

D11Mit163
Primer 1 Sequence

AACCCTGCTATTGTGCTGCT
Primer 2 Sequence

CTAGAACACACATGCATGCTCA
ID

MGI:704133
Product Size

134
Other IDs

D11Mit163 (BROAD)
Note

MIT assay: MT1391
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 163

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit163	a	137bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	b	141bp	AKR/J, BALB/cJ, LP/J, NOD/MrkTac
	c	145bp	SPRET/EiJ
	d	153bp	CAST/EiJ
	e	155bp	A/J, C3H/HeJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D11Mit163	a	155bp	A.CA/W, C3H/W, DBA/2W
	b	141bp	A.CA/W, BALB/cW
	c	137bp	AKR/W, C57BL/6W, C57BL/10W, CBA/W
	d	126bp	129/SvW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24