About   Help   FAQ
D19Mit53 Primer Detail
Primers
  • Name
    D19Mit53
  • Primer 1 Sequence
    GCACGCCACAACTCAGAG
  • Primer 2 Sequence
    AGAAAAGGTTCTCCTACCTCTCG
  • ID
    MGI:704138
  • Product Size
    111
  • Other IDs
    D19Mit53 (BROAD)
  • Note
    MIT assay: MT154
    Additional information: MIT STS Marker Data Files
Genes
D19Mit53 DNA segment, Chr 19, Massachusetts Institute of Technology 53
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit53 a 110bp 129X1/Sv
f 100, 110bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit53 a 98bp A/J, BALB/cJ, DBA/2J
b 100bp AKR/J, NOD/MrkTac, NON/ShiLt
c 102bp C3H/HeJ
d 106bp B6.Cg-Lepob/+
e 110bp C57BL/6J, CAST/EiJ, LP/J
f 118bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit53 c 144bp CBA/CaOlaHsd
s 137bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory