About   Help   FAQ
D3Mit278 Primer Detail
Primers
  • Name
    D3Mit278
  • Primer 1 Sequence
    AACTACCATCTAAAACATCCTCTGTG
  • Primer 2 Sequence
    AGATCCCTAGAGAAACAGAACTGG
  • ID
    MGI:704151
  • Product Size
    112
  • Other IDs
    D3Mit278 (BROAD)
  • Note
    MIT assay: MTAR159
    Additional information: MIT STS Marker Data Files
Genes
D3Mit278 DNA segment, Chr 3, Massachusetts Institute of Technology 278
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit278 a 92bp BALB/cJ, LP/J
b 106bp CAST/EiJ
c 108bp A/J
d 112bp AKR/J, C3H/HeJ, DBA/2J
e 116bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
f 120bp NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D3Mit278 b 110bp C57BL/6JOlaHsd, C57BL/10
c 88bp 129P3/J, BALB/cJ
d 106bp AKR/OlaHsd, C3H/HeJ, DBA/2J, SJL/J
j 94bp JF1
p 96bp PWB
w 102bp A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory