D17Mit93 Primer Detail MGI Mouse MGI:704157

D17Mit93 Primer Detail

Name

D17Mit93
Primer 1 Sequence

TGTCCTTCGAGTGTTTGTGTG
Primer 2 Sequence

TCCCCGGTGAATGAGTTATC
ID

MGI:704157
Product Size

153
Other IDs

D17Mit93 (BROAD)
Note

MIT assay: MPC1159
Additional information: MIT STS Marker Data Files

D17Mit93

DNA segment, Chr 17, Massachusetts Institute of Technology 93

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit93	b	156bp	C57BL/6J
		c	154bp	BALB/cJ
		s	143bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit93	a	140bp	LP/J, NOD/MrkTac, NON/ShiLt
	b	148bp	SPRET/EiJ
	c	154bp	BALB/cJ
	d	155bp	B6.Cg-Lep^ob/+
	e	156bp	C57BL/6J
	f	160bp	AKR/J
	g	162bp	A/J
	h	168bp	DBA/2J
	i	170bp	C3H/HeJ, CAST/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D17Mit93	c	smaller	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit93	c	144bp	CBA/CaOlaHsd
	D17Mit93	s	142bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit93	a	smaller	129P3/J
	D17Mit93	s	larger	SJL/J

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24