D17Mit94 Primer Detail MGI Mouse MGI:704160

D17Mit94 Primer Detail

Name

D17Mit94
Primer 1 Sequence

TGGAGAGGCATCCAACTCTC
Primer 2 Sequence

TTCCTCTTAGTCCACCTTTTGC
ID

MGI:704160
Product Size

146
Other IDs

D17Mit94 (BROAD)
Note

MIT assay: MMH162
Additional information: MIT STS Marker Data Files

D17Mit94

DNA segment, Chr 17, Massachusetts Institute of Technology 94

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit94	a	150bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	146bp	129X1/SvJ
		c	144, 150bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit94	a	126bp	CAST/EiJ
	b	144bp	A/J, AKR/J, C3H/HeJ, DBA/2J
	c	150bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	154bp	LP/J
	e	160bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13