About   Help   FAQ
D17Mit98 Primer Detail
Primers
  • Name
    D17Mit98
  • Primer 1 Sequence
    TTTGTGAGTATATTTGTGATGTGTGG
  • Primer 2 Sequence
    GTATGCTCAATTCTATTGGGTGC
  • ID
    MGI:704164
  • Product Size
    260
  • Other IDs
    D17Mit98 (BROAD)
  • Note
    MIT assay: MMH277
    Additional information: MIT STS Marker Data Files
Genes
D17Mit98a DNA segment, Chr 17, Massachusetts Institute of Technology 98a
D17Mit98b DNA segment, Chr 17, Massachusetts Institute of Technology 98b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit98a a 254bp SPRET/EiJ
b 258bp CAST/EiJ
c 260bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit98a c 146bp CBA/CaOlaHsd
s 121bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory