About   Help   FAQ
D2Mit525 Primer Detail
Primers
  • Name
    D2Mit525
  • Primer 1 Sequence
    CACCTGACATCGACCTCTGA
  • Primer 2 Sequence
    AGACCTGTGTGTCCATACACATG
  • ID
    MGI:704175
  • Product Size
    119
  • Other IDs
    D2Mit525 (BROAD)
  • Note
    MIT assay: MTH2458
    Additional information: MIT STS Marker Data Files
Genes
D2Mit525 DNA Segment, Chr 2, Massachusetts Institute of Technology 525
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit525 a 119bp B6.Cg-Lepob/+, C57BL/6J
b 125bp A/J, BALB/cJ, SPRET/EiJ
c 127bp AKR/J, C3H/HeJ, LP/J, NON/ShiLt
d 131bp CAST/EiJ, NOD/MrkTac
e 177bp DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D2Mit525 a 129bp 129P3/J, AKR/OlaHsd, C3H/HeJ, SJL/J
b 121bp C57BL/6JOlaHsd
c 127bp BALB/cJ, C57BL/10
d 181bp DBA/2J
j 105bp JF1
p 177bp PWB
w 125bp A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory