D10Mit123 Primer Detail MGI Mouse MGI:704197

D10Mit123 Primer Detail

Name

D10Mit123
Primer 1 Sequence

AAACTGGATGCAAAGGAAAGG
Primer 2 Sequence

GTTGATCTAATGGATCTTGCACA
ID

MGI:704197
Product Size

143
Other IDs

D10Mit123 (BROAD)
Note

MIT assay: MTH205
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 123

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit123	c	149bp	C3HeB/FeJLe
	D10Mit123	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit123	a	121bp	SPRET/EiJ
	b	137bp	CAST/EiJ
	c	141bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	143bp	DBA/2J, NON/ShiLt
	e	145bp	NOD/MrkTac
	f	149bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit123	c	152bp	CBA/CaOlaHsd
	D10Mit123	s	144bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24