D17Mit1 Primer Detail MGI Mouse MGI:704225

D17Mit1 Primer Detail

Name

D17Mit1
Primer 1 Sequence

TGCTTGAAATCCTGGGTTCA
Primer 2 Sequence

TGCAAAAATGTATGTGCCTG
ID

MGI:704225
Product Size

200
Note

MIT assay: M124

D17Mit1

DNA segment, Chr 17, Massachusetts Institute of Technology 1

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit1	a	202bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv, CD-1
Not Specified	D17Mit1	b	198bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit1	a	192bp	AKR/J
	b	194bp	A/J, BALB/cJ, C3H/HeJ
	c	200bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	d	202bp	LP/J, NOD/MrkTac
	e	206bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24