D4Mit71 Primer Detail MGI Mouse MGI:704231

D4Mit71 Primer Detail

Name

D4Mit71
Primer 1 Sequence

TGAAAGAAACCCCAAACTGC
Primer 2 Sequence

CACGAACATCCTCACACAATG
ID

MGI:704231
Product Size

117
Other IDs

D4Mit71 (BROAD)
Note

MIT assay: MPC1515
Additional information: MIT STS Marker Data Files

D4Mit71

DNA segment, Chr 4, Massachusetts Institute of Technology 71

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit71	b	larger	C57BL/6J
	D4Mit71	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit71	a	104bp	SPRET/EiJ
	b	112bp	CAST/EiJ
	c	114bp	A/J, AKR/J, C3H/HeJ, LP/J
	d	120bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	122bp	BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D4Mit71	a	120bp	BALB/cW, BN/aW, C57BL/6W, DBA/2W
	b	114bp	129/SvW, A.CA/W, AKR/W, C3H/W, CBA/W
	c	110bp	C57BL/10W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24