D11Mit54 Primer Detail MGI Mouse MGI:704255

D11Mit54 Primer Detail

Name

D11Mit54
Primer 1 Sequence

AGGCTGGTGGCTAGTGTCC
Primer 2 Sequence

AAGTCTTGCGCTGCATCTTT
ID

MGI:704255
Product Size

144
Other IDs

D11Mit54 (BROAD)
Note

MIT assay: D549
Additional information: MIT STS Marker Data Files

D11Mit54

DNA segment, Chr 11, Massachusetts Institute of Technology 54

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D11Mit54	b	largest	C57BL/6J
	c	138bp	C3HeB/FeJLe
	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit54	a	110bp	A/J
	b	112bp	AKR/J
	c	126bp	CAST/EiJ
	d	136bp	DBA/2J
	e	138bp	C3H/HeJ
	f	140bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	g	142bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24