About   Help   FAQ
D15Mit53 Primer Detail
Primers
  • Name
    D15Mit53
  • Primer 1 Sequence
    CTCCCTTACCTTCGGCTCTT
  • Primer 2 Sequence
    AGGGTAATTTCAATTAAACTCGTG
  • ID
    MGI:704265
  • Product Size
    137
  • Other IDs
    D15Mit53 (BROAD)
  • Note
    MIT assay: MPC315
    Additional information: MIT STS Marker Data Files
Genes
D15Mit53 DNA segment, Chr 15, Massachusetts Institute of Technology 53
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit53 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit53 a 140bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
b 144bp CAST/EiJ
c 146bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
d 148bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory