About   Help   FAQ
D18Mit103 Primer Detail
Primers
  • Name
    D18Mit103
  • Primer 1 Sequence
    GGCCTATGCCTACAGTAACTGG
  • Primer 2 Sequence
    CCAAAACAAACAACACGCAC
  • ID
    MGI:704273
  • Product Size
    115
  • Other IDs
    D18Mit103 (BROAD)
  • Note
    MIT assay: MT1298
    Additional information: MIT STS Marker Data Files
Genes
D18Mit103 DNA segment, Chr 18, Massachusetts Institute of Technology 103
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit103 a 93bp LP/J
b 109bp CAST/EiJ
c 117bp BALB/cJ
d 119bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
e 122bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit103 c 125bp CBA/CaOlaHsd
s 124bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory