About   Help   FAQ
D4Mit139 Primer Detail
Primers
  • Name
    D4Mit139
  • Primer 1 Sequence
    CAGCCGTAGAAGAGAAGTAATTTT
  • Primer 2 Sequence
    ATCAAACTGGGAAGAGCCAA
  • ID
    MGI:704290
  • Product Size
    149
  • Other IDs
    D4Mit139 (BROAD)
  • Note
    MIT assay: MT133
    Additional information: MIT STS Marker Data Files
Genes
D4Mit139 DNA segment, Chr 4, Massachusetts Institute of Technology 139
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit139 a 122bp CAST/EiJ
b 144bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
c 148bp LP/J, NON/ShiLt
d 152bp B6.Cg-Lepob/+, C57BL/6J
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit139 a 0.125kb CBA/Ca
c 0.125kb CAST/EiJ
w 0.15kb STOCK Whrnwi
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory