D12Mit101 Primer Detail MGI Mouse MGI:704345

D12Mit101 Primer Detail

Name

D12Mit101
Primer 1 Sequence

GCTTTTCCTTATCAAGATATGCG
Primer 2 Sequence

GCAGCAGAAAGAGAGGGAAA
ID

MGI:704345
Product Size

167
Other IDs

D12Mit101 (BROAD)
Note

MIT assay: MPC1706
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 101

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit101	c	118bp	C3HeB/FeJLe
	D12Mit101	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit101	a	112bp	SPRET/EiJ
	b	116bp	AKR/J, BALB/cJ, NOD/MrkTac
	c	118bp	A/J, C3H/HeJ, DBA/2J
	d	126bp	CAST/EiJ
	e	170bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24