D5Mit11 Primer Detail MGI Mouse MGI:704352

D5Mit11 Primer Detail

Name

D5Mit11
Primer 1 Sequence

GATCTTCCTACCTTCTTACCCAC
Primer 2 Sequence

CATGATTTTATTTGGGGGG
ID

MGI:704352
Product Size

206
Other IDs

D5Mit11 (BROAD)
Note

MIT assay: M97
Additional information: MIT STS Marker Data Files

D5Mit11

DNA segment, Chr 5, Massachusetts Institute of Technology 11

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit11	m	210bp	MOLF/EiJ
Not Specified	D5Mit11	s	absent	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit11	a	188bp	A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	195bp	CAST/EiJ
	c	199bp	BALB/cJ
	d	203bp	B6.Cg-Lep^ob/+, LP/J
	e	206bp	C57BL/6J
	f	210bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit11	c	133bp	CBA/CaOlaHsd
	D5Mit11	s	136bp	SWR/OlaHsd

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24