D5Mit10 Primer Detail MGI Mouse MGI:704353

D5Mit10 Primer Detail

Name

D5Mit10
Primer 1 Sequence

CGAGAAGTTGGAAAGACCCA
Primer 2 Sequence

GGCACCCATGCCTCTATG
ID

MGI:704353
Product Size

195
Other IDs

D5Mit10 (BROAD)
Note

MIT assay: M207
Additional information: MIT STS Marker Data Files

D5Mit10

DNA segment, Chr 5, Massachusetts Institute of Technology 10

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit10	a	largest	DBA/2
		b	smaller	C57BL/6
		c	smallest	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit10	a	188bp	A/J
	b	190bp	BALB/cJ
	c	192bp	NON/ShiLt
	d	194bp	C3H/HeJ
	e	196bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	f	200bp	NOD/MrkTac
	g	201bp	AKR/J
	h	203bp	DBA/2J
	i	205bp	SPRET/EiJ
	j	209bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D5Mit10	a	204bp	AKR/OlaHsd
	b	198bp	129P3/J, C57BL/6JOlaHsd, C57BL/10
	c	190bp	A/JOlaHsd, BALB/cJ
	d	206bp	DBA/2J
	h	196bp	C3H/HeJ, SJL/J
	j	184bp	JF1
	p	194bp	PWB

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit10	l	smaller	LG/J
	D5Mit10	s	larger	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit10	c	156bp	CBA/CaOlaHsd
	D5Mit10	s	123bp	SWR/OlaHsd

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24