D5Mit13 Primer Detail MGI Mouse MGI:704354

D5Mit13 Primer Detail

Name

D5Mit13
Primer 1 Sequence

CATCGTTGCTCTTGACAGGA
Primer 2 Sequence

CCGGGAGAACCCAAATAAGT
ID

MGI:704354
Product Size

191
Other IDs

D5Mit13 (BROAD)
Note

MIT assay: B455
Additional information: MIT STS Marker Data Files

D5Mit13

DNA segment, Chr 5, Massachusetts Institute of Technology 13

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit13	a	176bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, NON/ShiLt
	b	190bp	SPRET/EiJ
	c	194bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit13	c	158bp	CBA/CaOlaHsd
	D5Mit13	s	159bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit13	a	194bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	D5Mit13	b	176bp	A.CA/W, AKR/W, BALB/cW, C3H/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24