D6Mit200 Primer Detail MGI Mouse MGI:704365

D6Mit200 Primer Detail

Name

D6Mit200
Primer 1 Sequence

CATCAGGTGTCTTCAGGTTCTG
Primer 2 Sequence

TCCCCTCTATCCTTACTGTTGC
ID

MGI:704365
Product Size

105
Other IDs

D6Mit200 (BROAD)
Note

MIT assay: MT2518
Additional information: MIT STS Marker Data Files

D6Mit200

DNA segment, Chr 6, Massachusetts Institute of Technology 200

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit200	a	106bp	129X1/Sv
Not Specified	D6Mit200	f	98, 102, 106bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit200	a	98bp	NOD/MrkTac, NON/ShiLt
	b	102bp	AKR/J, C3H/HeJ, DBA/2J
	c	104bp	SPRET/EiJ
	d	106bp	LP/J
	e	108bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	f	116bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24