D10Mit264 Primer Detail MGI Mouse MGI:704377

D10Mit264 Primer Detail

Name

D10Mit264
Primer 1 Sequence

TGGTATGGATCAATGTGAAATTC
Primer 2 Sequence

CTTTACTCATCTATACCAAGGGGC
ID

MGI:704377
Product Size

118
Note

MIT assay: MTH918

DNA Segment, Chr 10, Massachusetts Institute of Technology 264

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit264	a	118bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	b	162bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
	c	164bp	SPRET/EiJ
	d	178bp	CAST/EiJ, LP/J
	e	190bp	AKR/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D10Mit264	a	190bp	AKR/W
	b	162bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
	c	118bp	129/SvW, C57BL/6W, C57BL/10W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit264	c	upper	CBA/Kw
	D10Mit264	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24