D10Mit266 Primer Detail MGI Mouse MGI:704379

D10Mit266 Primer Detail

Name

D10Mit266
Primer 1 Sequence

ACCAACTACACAACATTGTCTTCTG
Primer 2 Sequence

CAGTTGCAAAGATGCCACC
ID

MGI:704379
Product Size

94
Other IDs

D10Mit266 (BROAD)
Note

MIT assay: MTH533
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 10, Massachusetts Institute of Technology 266

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit266	a	92bp	A/J, BALB/cJ, NOD/MrkTac
	D10Mit266	b	100bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D10Mit266	c	87bp	A/JOlaHsd, BALB/cJ
	d	95bp	AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	g	89bp	129P3/J, SJL/J
	p	73bp	JF1, PWB

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit266	l	smaller	LG/J
	D10Mit266	s	larger	SM/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24